Sequence ID | >WENV170643749 |
Genome ID | JMBV01000472 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 8038 |
End posion on genome | 8113 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tttttctgaT |
tRNA gene sequence |
TCCTCCTTAGCTCAGTTGGTTAGAGCATCTGACTGTTAATCAGAGGGTCGCTGGTTCAAG |
Downstream region at tRNA end position |
ttggtaaaga |
Secondary structure (Cloverleaf model) | >WENV170643749 Asn GTT T GAgc ttggtaaaga T + G C - G C - G T + G C - G C - G T - A T G T C G A C C A T G A A | | | | | A T C T C G G C T G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |