Sequence ID | >WENV170643917 |
Genome ID | JMBV01007931 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 450 |
End posion on genome | 526 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
cgggcgacgg |
tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTTAGAGCGTCAGCCTTCCAAGCTGAAGGTCGCGGGTTCGAA |
Downstream region at tRNA end position |
ttaatgctag |
Secondary structure (Cloverleaf model) | >WENV170643917 Gly TCC g TCCA ttaatgctag G - C C - G G - C G - C G - C A - T A - T T A T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T T A G AGGTC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |