Sequence ID | >W141443739 |
Genome ID | JEXH01000013 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Acinetobacter sp. 869535 869535 [JEXH] |
Start position on genome | 55420 |
End posion on genome | 55504 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttatatcatc |
tRNA gene sequence |
GGGGGCGTGGCGAAATTGGTAGACGCACTGGATTTAGGTTCCAGCGCCGCGAGGTGTAAG |
Downstream region at tRNA end position |
atgatgatag |
Secondary structure (Cloverleaf model) | >W141443739 Leu TAG c ACCA atgatgatag G - C G - C G - C G - C G - C C - G G - C T G T T T C T C A T A A G | | | | | G T A G C G A A G A G C G | | | T T G A C G C T A G A CGCCGCGAGGTGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |