Sequence ID | >WENV170644098 |
Genome ID | JMBV01038407 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 232 |
End posion on genome | 308 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
acctgatatt |
tRNA gene sequence |
GGGCCCGTAGCTTAGCCTGGTGGAGCGCACGGCTGATAACCGTGAGGTCCTGCGTTCGAA |
Downstream region at tRNA end position |
caattcagca |
Secondary structure (Cloverleaf model) | >WENV170644098 Ile GAT t ACCA caattcagca G - C G - C G - C C - G C - G C - G G - C T A T G A C G C A C G A A | | | | | G C T T C G C T G C G C T + | | | T T G G A G C G T G G AGGTC C - G A - T C - G G - C G - C C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |