Sequence ID | >WENV170644370 |
Genome ID | JMBW01008564 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 58 |
End posion on genome | 132 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
accttgacga |
tRNA gene sequence |
GCGGATGTGGCTCAGCGGTAGAGCATCGGCTTCCCAAGCCGAGGATCGCGGGTTCGAATC |
Downstream region at tRNA end position |
ttttatgtac |
Secondary structure (Cloverleaf model) | >WENV170644370 Gly CCC a TCCA ttttatgtac G - C C - G G - C G - C A - T T - A G - C T A T T G C C C A G A G + | | | | G C C T C G G C G G G C G | | | | T T G G A G C T A A GGATC T - A C - G G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |