Sequence ID | >WENV170644750 |
Genome ID | JMBW01081482 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 51 |
End posion on genome | 126 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tagcgcttat |
tRNA gene sequence |
GCTGGTGTAGCTCAATTGGCAGAGCAACTGACTTGTAATCAGTAGGTTGGGGGTTCAATT |
Downstream region at tRNA end position |
tctagctttt |
Secondary structure (Cloverleaf model) | >WENV170644750 Thr TGT t TCCA tctagctttt G - C C - G T - A G - C G - C T - A G - C T T T T C T C C A T A A A + | + | | A T C T C G G G G G G C G | | | | T T G G A G C C A A AGGTT A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |