Sequence ID | >WENV170644810 |
Genome ID | JMBW01105737 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 13 |
End posion on genome | 87 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
aagacaaaga |
tRNA gene sequence |
ACATCAGTAGTGTAGCGGTCATCACCGGGCGTTGCCAACGCTCGAACCCGGGTTCGAATC |
Downstream region at tRNA end position |
taaacttttt |
Secondary structure (Cloverleaf model) | >WENV170644810 Gly GCC a ATCA taaacttttt A - T C - G A - T T - A C - G A - T G - C T A T G G C C C A C G A A | | | | | G G T G T G C C G G G C G | | | T T T T C A C C A C GAAC G - C G + T G - C C - G G - C T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |