Sequence ID | >WENV170644811 |
Genome ID | JMBW01105737 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 145 |
End posion on genome | 220 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ataaactatT |
tRNA gene sequence |
GGGCTCGTGGTCTAGACGGTTATGACGTCGCCTTGACATGGCGGAGGTCCTGAGTTCGAA |
Downstream region at tRNA end position |
aaattttccg |
Secondary structure (Cloverleaf model) | >WENV170644811 Val GAC T ATta aaattttccg G - C G - C G - C C - G T + G C - G G - C T A T G A C T C A A G A G | | | | | G C T C T G C T G A G C G | | | T T G T G A C T T A G AGGTC T + G C - G G - C C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |