Sequence ID | >WENV170644861 |
Genome ID | JMBW01140025 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 73 |
End posion on genome | -1 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
caacccactT |
tRNA gene sequence |
TCCTCGGTAGCTCAGTGGTAGAGCGGTCGGCTGTTAACCGATTGGTCGTAGGTTCGAATC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170644861 Asn GTT T GNNn nnnnnnnnnn T + G C - G C - G T + G C - G G - C G - C T A T C A T C C A G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C T A G TGGTC G + T T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |