Sequence ID | >WENV170644886 |
Genome ID | JMBX01000020 |
Search identical group | |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 14645 |
End posion on genome | 14733 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tctcctgcct |
tRNA gene sequence |
GGAGAGATGCTCGAGTGGTTGAAGAGGCACGCCTGGAAAGCGTGTATACGCCAAAAGTGT |
Downstream region at tRNA end position |
cctcgtaaaa |
Secondary structure (Cloverleaf model) | >WENV170644886 Ser GGA t GCac cctcgtaaaa G - C G - C A - T G - C A - T G - C A - T T A T C G C C C A T G A G | | | | | G G G C T C G C G G G C G | | | T T T A G A G T G A G TATACGCCAAAAGTGTATC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |