Sequence ID | >WENV170644977 |
Genome ID | JMBX01000544 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 7289 |
End posion on genome | 7365 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gtacgtataa |
tRNA gene sequence |
GGGCTCGTAGCTCAGTTGGTTAGAGCTTCCGGCTCATAACCGGGTGGTCGGTGGTTCGAA |
Downstream region at tRNA end position |
ataaaagccg |
Secondary structure (Cloverleaf model) | >WENV170644977 Met CAT a ACCA ataaaagccg G - C G - C G - C C - G T - A C - G G - C T A T C C A C C A T G A A | | | | | G T C T C G G G T G G C G | | | | T T G G A G C T T A T TGGTC T + G C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |