Sequence ID | >WENV170645033 |
Genome ID | JMBX01001516 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 74 |
End posion on genome | 1 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
aattagaaac |
tRNA gene sequence |
GGGTGCGTAGCTCAGTGGGAGAGCGCTTCCTTGACGCGGAAGAGGCCGTAGGTTCAATCC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170645033 Val GAC c ACCn nnnnnnnnnn G - C G - C G - C T - A G - C C - G G - C C T T C A T C C A G A A | | | | | A T C T C G G T A G G C G | | | | T T G G A G C G A G AGGCC C - G T - A T - A C - G C - G T C T G G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |