Sequence ID | >WENV170645078 |
Genome ID | JMBX01002466 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1370 |
End posion on genome | 1446 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aatataatat |
tRNA gene sequence |
GGGCCTGTAGCTCAGGTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTGGTTCGAG |
Downstream region at tRNA end position |
ctttattcgc |
Secondary structure (Cloverleaf model) | >WENV170645078 Ile GAT t ACCA ctttattcgc G - C G - C G - C C - G C - G T - A G - C T G T C C A C C A G G A A | | | | | G T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |