Sequence ID | >WENV170645203 |
Genome ID | JMBX01017775 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 233 |
End posion on genome | 157 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ataagaaaat |
tRNA gene sequence |
GGCCCGGTAGTTCAGATGGTTAGAATGCCAGCCTGTCACGCTGGAGGTCGAGGGTTCGAG |
Downstream region at tRNA end position |
tgctggtgta |
Secondary structure (Cloverleaf model) | >WENV170645203 Asp GTC t GCCA tgctggtgta G - C G + T C - G C - G C - G G - C G - C T G T T T C C C A A G A A + | | | | G T C T T G G A G G G C G | | | + T T G G A A T T T A G AGGTC C - G C - G A - T G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |