Sequence ID | >WENV170645259 |
Genome ID | JMBX01026095 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 193 |
End posion on genome | 117 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaccaattat |
tRNA gene sequence |
GGCGGCGTAGCTCAGTTGGCTAGAGCATGCGGTTCATACCCGCAGTGTCAGCGGTTCAAA |
Downstream region at tRNA end position |
agtttatatg |
Secondary structure (Cloverleaf model) | >WENV170645259 Met CAT t ACCA agtttatatg G + T G - C C - G G - C G - C C - G G - C T A T T T G C C A T G A A | + | | | A T C T C G A G C G G C G | | | | T T G G A G C C T A A GTGTC T - A G - C C - G G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |