Sequence ID | >WENV170645342 |
Genome ID | JMSV01000507 |
Phylum/Class | [JMSV] bioreactor metagenome; Culture-2 Bioreactor Bmz derived from microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 847 |
End posion on genome | 941 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
caacaggtac |
tRNA gene sequence |
GGAGAGGTGGCCGAGCACGGCTGAAGGCGCTCGCCTGCTAAGCGAGTATAGGGCTTAAAA |
Downstream region at tRNA end position |
catgaaagtt |
Secondary structure (Cloverleaf model) | >WENV170645342 Ser GCT c GCCA catgaaagtt G - C G - C A - T G - C A - T G - C G - C T A T G C C C C A A C G A G | | | | | A C G C C G C G G G G C G | | | T T G A G G C C T G A G TATAGGGCTTAAAACTCTATC C - G T - A C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |