Sequence ID | >WENV170645351 |
Genome ID | JMSV01000543 |
Phylum/Class | [JMSV] bioreactor metagenome; Culture-2 Bioreactor Bmz derived from microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 2159 |
End posion on genome | 2066 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
tcttcgcaat |
tRNA gene sequence |
GGAAGTGTATCGTCACCGGTGTGGCGCCTGGACTTCAAATCCAGTGGACGGGTTAACGCT |
Downstream region at tRNA end position |
cttttttaaa |
Secondary structure (Cloverleaf model) | >WENV170645351 SeC(p) TCA t GCCA cttttttaaa G - C G - C A - T A - T G - C T - A G - C T - A T C A T A T C C A C C A T + | | | | G G C T G C G T A G G C G | + | | T T T G G C G G T C TGGACGGGTTAACGCTCGTCG C - G T - A G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |