Sequence ID | >WENV170645375 |
Genome ID | JMSV01001102 |
Phylum/Class | [JMSV] bioreactor metagenome; Culture-2 Bioreactor Bmz derived from microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 1210 |
End posion on genome | 1296 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tcttccgagt |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACACGCTAGGTTCAGGGTCTAGTGGGGGTTCCCCCGTG |
Downstream region at tRNA end position |
ctcgtaaata |
Secondary structure (Cloverleaf model) | >WENV170645375 Leu CAG t ACCA ctcgtaaata G - C C - G C - G G - C A - T A - T G - C T G T T C T T C A T A A G + | | | | G T G G T G G G A A G C G | | | T T G A C A C T A G G TGGGGGTTCCCCCGT C - G T - A A - T G - C G + T T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |