Sequence ID | >WENV170645449 |
Genome ID | JMSV01005218 |
Phylum/Class | [JMSV] bioreactor metagenome; Culture-2 Bioreactor Bmz derived from microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 474 |
End posion on genome | 561 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ctgacaatgt |
tRNA gene sequence |
GCCTGGGTGGCGGAACTGGTAGACGCAAGGGACTTAAAATCCCTCGGGGCTGAGCCCTGT |
Downstream region at tRNA end position |
ttaaaatcaa |
Secondary structure (Cloverleaf model) | >WENV170645449 Leu TAA t ACCA ttaaaatcaa G + T C - G C - G T - A G - C G - C G - C T T T T G C T C A C A A G | | | | | A T G G C G A C G A G C G | | | T T G A C G C T A G A CGGGGCTGAGCCCTGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |