Sequence ID | >WENV170645451 |
Genome ID | JMSV01005284 |
Phylum/Class | [JMSV] bioreactor metagenome; Culture-2 Bioreactor Bmz derived from microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 464 |
End posion on genome | 548 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aataaagttt |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACACGCACGCTTGAGGGGCGTGTGGGGCGACCCGTGGG |
Downstream region at tRNA end position |
catatacctg |
Secondary structure (Cloverleaf model) | >WENV170645451 Leu GAG t ACCA catatacctg G - C C - G C - G G - C A - T A - T G - C T A T C C C T C A T A A G | | | | | A T G G T G G G G A G C G | | | T T G A C A C T A G G TGGGGCGACCCGT C - G A - T C - G G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |