Sequence ID | >WENV170645456 |
Genome ID | JMSV01005995 |
Phylum/Class | [JMSV] bioreactor metagenome; Culture-2 Bioreactor Bmz derived from microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 132 |
End posion on genome | 46 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tcttcgccgt |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACACGCTAGGTTCAGGGTCTAGTGGAGGTTTCTCCGTG |
Downstream region at tRNA end position |
tttttctaaa |
Secondary structure (Cloverleaf model) | >WENV170645456 Leu CAG t ACCA tttttctaaa G - C C - G C - G G - C A - T A - T G - C T A T T C T T C A T A A G + | | | | G T G G T G G G A A G C G | | | T T G A C A C T A G G TGGAGGTTTCTCCGT C - G T - A A - T G - C G + T T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |