Sequence ID | >WENV170646043 |
Genome ID | JQGF01014433 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 219 |
End posion on genome | 144 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tcatccagaa |
tRNA gene sequence |
GCCGCTTTAGCTCAGTTGGTAGAGCACTCGCCTTGTAAGCGATAGGTCGTCTGTTCGAGT |
Downstream region at tRNA end position |
tccggggact |
Secondary structure (Cloverleaf model) | >WENV170646043 Thr TGT a ACCA tccggggact G - C C - G C - G G - C C - G T - A T - A T G T C A G A C A T G A A | | | | | G T C T C G G T C T G C G | | | | T T G G A G C T A A AGGTC C T T - A C - G G - C C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |