Sequence ID | >WENV170646125 |
Genome ID | JQGF01103221 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 38 |
End posion on genome | 114 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aatctaatat |
tRNA gene sequence |
GCCTCGGTAGCTCAGTCTGGTGGAGCGCGAGACTTGTAATCTCGTGGTCGCGGGTTCAAT |
Downstream region at tRNA end position |
aaaccgtgga |
Secondary structure (Cloverleaf model) | >WENV170646125 Thr TGT t TCTA aaaccgtgga G - C C - G C - G T + G C - G G - C G - C T T T T G C C C A T G A A + | | | | A C C T C G G C G G G C T | | | | T T G G A G C G T G G TGGTC C - G G - C A - T G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |