Sequence ID | >WENV170646127 |
Genome ID | JQGF01103221 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 234 |
End posion on genome | 307 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ccatccaaaa |
tRNA gene sequence |
CCCGCCTTAGCTCAATTTGGCAGAGCATCGGACTGTAGATCCGAGGGTTGCTGGTTCAAG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170646127 Tyr GTA a Attt nnnnnnnnnn C - G C - G C - G G - C C - G C - G T - A T G T C G G C C A T A A A | | + | | A T C T C G G C T G G C T | | | | T T G G A G C G C A A GGGTT T - A C - G G - C G - C A - T C A T G G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |