Sequence ID | >WENV170646133 |
Genome ID | JQGF01112592 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 125 |
End posion on genome | 50 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ttcgccggat |
tRNA gene sequence |
GCCCAGATAGCTCAGTTGGTAGAGCATGCGACTGAAAATCGCAGTGTCGCTGGTTCGATT |
Downstream region at tRNA end position |
tttttctttc |
Secondary structure (Cloverleaf model) | >WENV170646133 Phe GAA t ACCA tttttctttc G - C C - G C - G C - G A - T G - C A - T T T T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A A GTGTC T - A G - C C - G G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |