Sequence ID | >WENV170646152 |
Genome ID | JQGG01001674 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 754 |
End posion on genome | 679 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gaagcagtag |
tRNA gene sequence |
GGGGCTGTAGCTCAGCTGGGAGAGCGGCGGCTTTGCAAGCCGTAGGTCGTCGGTTCGATC |
Downstream region at tRNA end position |
gtactgtcca |
Secondary structure (Cloverleaf model) | >WENV170646152 Ala TGC g ACCA gtactgtcca G - C G - C G + T G - C C - G T - A G - C C T T C A G C C A C G A A | | | | | G T C T C G G T C G G C G | | | | T T G G A G C G A G AGGTC G + T C - G G - C G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |