Sequence ID | >WENV170646164 |
Genome ID | JQGG01005276 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 126 |
End posion on genome | 201 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gagaagcagt |
tRNA gene sequence |
GCCCTGATAGCTCAGTTGGCAGAGCGCGTCCTTGGTAAGGACGAGGTCACCAGTTCAATC |
Downstream region at tRNA end position |
tttcgaagtt |
Secondary structure (Cloverleaf model) | >WENV170646164 Thr GGT t TCCA tttcgaagtt G - C C - G C - G C - G T - A G - C A - T C T T T G G T C A T G A A | | | | | A T C T C G A C C A G C G | | | | T T G G A G C C A G AGGTC C - G G - C T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |