Sequence ID | >WENV170646194 |
Genome ID | JQGG01025527 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 153 |
End posion on genome | 228 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
taagtgcaac |
tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGTCGCGAGTTCGAGC |
Downstream region at tRNA end position |
atcaagttaa |
Secondary structure (Cloverleaf model) | >WENV170646194 Gly GCC c TCCA atcaagttaa G - C C - G G - C G - C G - C A - T A - T C G T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A G AGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |