Sequence ID | >WENV170646288 |
Genome ID | JQGG01138102 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 147 |
End posion on genome | 220 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
cgttacgcac |
tRNA gene sequence |
GCGGACGTAGCTCAATGGTAGAGCCCCAGTCTTCCAAACTGGCTACGCGGGTTCGATTCC |
Downstream region at tRNA end position |
agccaacgcg |
Secondary structure (Cloverleaf model) | >WENV170646288 Gly TCC c TCCA agccaacgcg G - C C - G G - C G - C A - T C - G G - C T T T T G C C C A A A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A C CTAC C - G C - G A - T G - C T - A C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |