Sequence ID | >WENV170646293 |
Genome ID | JQGG01148273 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 164 |
End posion on genome | 240 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agaatttatt |
tRNA gene sequence |
GGGCCTATAGCTCATTCGGTTAGAGCAACTGACTCATAATCAGTAGGTGCTTGGTTCGAT |
Downstream region at tRNA end position |
aaagccttca |
Secondary structure (Cloverleaf model) | >WENV170646293 Met CAT t ACGA aaagccttca G - C G - C G - C C - G C - G T + G A - T T T T G A A C C A T T A A | | | | | G C C T C G C T T G G C G | | | | T T G G A G C T T A A AGGTG A - T C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |