Sequence ID | >WENV170646296 |
Genome ID | JQGG01153626 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 49 |
End posion on genome | 123 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
agtagctgtT |
tRNA gene sequence |
GGGCAGGTAGATCAGCTGGAAGATCGCTACCTTGGCATGGTAGAGGCCTCGGGTTCAAAT |
Downstream region at tRNA end position |
ctcttttttt |
Secondary structure (Cloverleaf model) | >WENV170646296 Ala GGC T ATat ctcttttttt G - C G - C G + T C - G A - T G - C G - C T A T A G C C C A C G A A | | | | | A T C T A G T C G G G C G | | | | T T G G A T C A A G AGGCC C - G T - A A - T C - G C - G T T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |