Sequence ID | >WENV170646358 |
Genome ID | JQGR01000167 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 7345 |
End posion on genome | 7256 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tgcccgggtc |
tRNA gene sequence |
GGAGGAGTGGCAGAGTGGTTGAATGCACCGGTCTTGAAAACCGACGTAGGTGAAAGTCTA |
Downstream region at tRNA end position |
tatgcttaaa |
Secondary structure (Cloverleaf model) | >WENV170646358 Ser TGA c GCCA tatgcttaaa G - C G - C A - T G - C G - C A - T G - C T A T C A C C C A T G A G | | | | | G G G A C G G T G G G C G | | | T T T A T G C T G A A CGTAGGTGAAAGTCTACC C A C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |