Sequence ID | >WENV170646359 |
Genome ID | JQGR01000170 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 4060 |
End posion on genome | 4134 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gttctcccat |
tRNA gene sequence |
GCCCGGGTAGCTCAGGGGTAGAGCAGTGGATTGAAAATCCTCGTGTCGGTGGTTCGATTC |
Downstream region at tRNA end position |
ttcatacctt |
Secondary structure (Cloverleaf model) | >WENV170646359 Phe GAA t ACCA ttcatacctt G - C C - G C - G C - G G - C G - C G - C T T T C C G C C A G A A | | + | | G G C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C T T G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |