Sequence ID | >WENV170646361 |
Genome ID | JQGR01000172 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 8843 |
End posion on genome | 8769 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
cgaacacggt |
tRNA gene sequence |
GCGGGCGTAGCTCAGGGGTAGAGCATAACCTTGCCAAGGTTAGGGTCGGGCGTTCGAATC |
Downstream region at tRNA end position |
atcaaaaaag |
Secondary structure (Cloverleaf model) | >WENV170646361 Gly GCC t TCCA atcaaaaaag G - C C - G G - C G - C G - C C - G G - C T A T T C C G C A G A A + | | | | G G C T C G G G G C G C G | | | | T T G G A G C T A A GGGTC T - A A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |