Sequence ID | >WENV170646370 |
Genome ID | JQGR01000301 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 4602 |
End posion on genome | 4527 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ttattctttt |
tRNA gene sequence |
AGGTCAGTAGCTCCAATGGTAGAGCGCCGGATTCCAAATCCGACGGTTGGGGGTTCGAGT |
Downstream region at tRNA end position |
taataattaa |
Secondary structure (Cloverleaf model) | >WENV170646370 Trp CCA t GCCA taataattaa A - T G - C G - C T + G C - G A - T G - C T G T C T C C C A A A C A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A G CGGTT C A C - G G - C G - C A - T T A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |