Sequence ID | >WENV170646378 |
Genome ID | JQGR01000371 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 733 |
End posion on genome | 647 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
acaaaaaagt |
tRNA gene sequence |
GCGAGTGTGGCGGAATAGGTAGACGCGTGGGACTTAAAATCCCATTCCGGTTTCGGAGTG |
Downstream region at tRNA end position |
cttttttaat |
Secondary structure (Cloverleaf model) | >WENV170646378 Leu TAA t ACCA cttttttaat G - C C - G G - C A - T G + T T - A G - C T T T C A C T C A T A A G | | | | | G A G G C G G T G A G C G | | | T T G A C G C T A G G TTCCGGTTTCGGAGT T - A G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |