Sequence ID | >WENV170646384 |
Genome ID | JQGR01000603 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 638 |
End posion on genome | 554 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aattttcaac |
tRNA gene sequence |
GGTGAGGTTGGAGAGTGGTCAAATCCAGGAGACTGTAAATCTCCCGCCTATGGCTTCGAA |
Downstream region at tRNA end position |
cgcaaatgat |
Secondary structure (Cloverleaf model) | >WENV170646384 Tyr GTA c ACCA cgcaaatgat G - C G - C T - A G - C A - T G - C G + T T A T C T T C C A T G A T | | | | | A G G A G G G A A G G C G | | | T T T A T C C C A A A CGCCTATGGCTTC G - C G - C A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |