Sequence ID | >WENV170646419 |
Genome ID | JQGR01003097 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 723 |
End posion on genome | 649 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cttaaaacat |
tRNA gene sequence |
TGGGGTATCGCCAAGTGGTAAGGCAACGGCTTTTGGTGCCGTCATTCGAAGGTTCGAATC |
Downstream region at tRNA end position |
cttttaagta |
Secondary structure (Cloverleaf model) | >WENV170646419 Gln TTG t TCCA cttttaagta T - A G - C G - C G - C G - C T - A A - T T A T C T T C C A G A C | | | | | G T A C C G G A A G G C G | | | T T G A G G C T A A CATTC A - T C - G G - C G - C C - G T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |