Sequence ID | >WENV170646420 |
Genome ID | JQGR01003097 |
Search identical group | |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 629 |
End posion on genome | 553 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agtttcgtat |
tRNA gene sequence |
CGCGGAATAGAGCAGTTCGGTAGCTCGTCGGGCTCATAACCCGAAGGTCACAGGTTCAAA |
Downstream region at tRNA end position |
attaaaaatt |
Secondary structure (Cloverleaf model) | >WENV170646420 Met CAT t ACCA attaaaaatt C A G - C C - G G - C G - C A - T A - T T A T T G T C C A T G A A | | | | | A T C G A G A C A G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |