Sequence ID | >WENV170648773 |
Genome ID | JRHI01002159 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 1991 |
End posion on genome | 1905 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gcttgctgtc |
tRNA gene sequence |
GCCCAGATGGCGGAATTGGTAGACGCACTAGGTTCAGGTCCTAGCGGTGGCAACACTGTG |
Downstream region at tRNA end position |
tagccataca |
Secondary structure (Cloverleaf model) | >WENV170648773 Leu CAG c ACCA tagccataca G - C C - G C - G C - G A - T G - C A - T T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G A CGGTGGCAACACTGT C - G T - A A - T G - C G - C T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |