| Sequence ID | >WENV170649618 |
| Genome ID | JRYC01037945 |
| Phylum/Class | [JRYC] activated sludge metagenome; activated biomass of a common effluent treatment plant treating industrial wastewater |
| Species | |
| Start position on genome | 365 |
| End posion on genome | 289 |
| Amino Acid | Arg |
| Anticodon | TCG |
| Upstream region at tRNA start position |
acgcaaatgt |
| tRNA gene sequence |
GCACCCGTAGCTCAGCTGGATAGAGTATCTGACTTCGAATCAGAGGGTCGCATGTTCGAA |
| Downstream region at tRNA end position |
ttcatctttt |
| Secondary structure (Cloverleaf model) | >WENV170649618 Arg TCG
t ACCA ttcatctttt
G + T
C - G
A - T
C - G
C - G
C - G
G - C T A
T C G T T C A
C G A A | | | | G
T C T C G G C A T G C
G | | | + T T
G G A G T
A T A A GGGTC
T - A
C - G
T - A
G - C
A - T
C A
T A
T C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |