Sequence ID | >WENV170650863 |
Genome ID | JRYE01036576 |
Search identical group | |
Phylum/Class | [JRYE] activated sludge metagenome; activated biomass in a lab-scale reactor treating industrial wastewater at 4 ppm DO |
Species | |
Start position on genome | 91 |
End posion on genome | 2 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gccgccggac |
tRNA gene sequence |
GGACAGGTGGCCGAGTGGTTGAAGGCGCACGCCTGGAACGCGTGTATACGTGAAAGCGTA |
Downstream region at tRNA end position |
tnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170650863 Ser GGA c GCCA tnnnnnnnnn G - C G - C A - T C C A - T G - C G + T T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C T G A G TATACGTGAAAGCGTATC C - G A - T C - G G - C C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |