Sequence ID | >WENV170651104 |
Genome ID | JRYF01000803 |
Search identical group | |
Phylum/Class | [JRYF] activated sludge metagenome; activated biomass of a wastewater treatment plant treating hydrocarbon contaminated |
Species | |
Start position on genome | 89392 |
End posion on genome | 89468 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ctgtattcgt |
tRNA gene sequence |
GGCTGGGTAGCTCAGATGGTTAGAGCGTGGGATTCATAACCCCAAGGTCGGGAGTTCGAT |
Downstream region at tRNA end position |
gtaaatatgg |
Secondary structure (Cloverleaf model) | >WENV170651104 Met CAT t ACCA gtaaatatgg G - C G - C C - G T C G - C G - C G - C C T T C C C T C A A G A A | | | | | G T C T C G G G G A G C G | | | | T T G G A G C T T A G AGGTC T - A G - C G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |