Sequence ID | >WENV170651358 |
Genome ID | JRYF01008710 |
Search identical group | |
Phylum/Class | [JRYF] activated sludge metagenome; activated biomass of a wastewater treatment plant treating hydrocarbon contaminated |
Species | |
Start position on genome | 283 |
End posion on genome | 208 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gcggcctttc |
tRNA gene sequence |
GCCGGTGTAGCTCAGCTGGTAGAGCAGCGCATTCGTAATGCGAAGGTCGGGAGTTCGACT |
Downstream region at tRNA end position |
tgacctcggg |
Secondary structure (Cloverleaf model) | >WENV170651358 Thr CGT c ACCA tgacctcggg G - C C - G C - G G - C G - C T - A G - C T C T T T C T C A C G A A + + | | | G T C T C G G G G A G C G | | | | T T G G A G C T A A AGGTC G A C - G G - C C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |