Sequence ID | >WENV170651828 |
Genome ID | JRYG01004915 |
Search identical group | |
Phylum/Class | [JRYG] activated sludge metagenome; activated biomass of a wastewater treatment plant treating hydrocarbon contaminated |
Species | |
Start position on genome | 493 |
End posion on genome | 418 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ctagcgtgcc |
tRNA gene sequence |
GGGCGGTTAGCTCAGTTGGTAGAGCGCCTCGTTTACACCGAGGATGTCGGGGGTTCGAGT |
Downstream region at tRNA end position |
cgtttccgtc |
Secondary structure (Cloverleaf model) | >WENV170651828 Val TAC c ACCC cgtttccgtc G - C G - C G - C C - G G - C G + T T - A T G T C T C C C A T G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A G ATGTC C - G C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |