Sequence ID | >WENV170652211 |
Genome ID | JRYH01000097 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1623 |
End posion on genome | 1548 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
aacatgaaat |
tRNA gene sequence |
GCCCAGGTAGCTCAGTTGGTAGAGCAGCGGATTGAAAATCCGCGTGTCGGTGGTTCGATT |
Downstream region at tRNA end position |
cttccccgcc |
Secondary structure (Cloverleaf model) | >WENV170652211 Phe GAA t ACCA cttccccgcc G - C C - G C - G C - G A - T G - C G - C T T T C C G C C A T G A A | | + | | G T C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C C - G G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |