Sequence ID | >WENV170652254 |
Genome ID | JRYH01000325 |
Search identical group | |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 106626 |
End posion on genome | 106552 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gcctcttttg |
tRNA gene sequence |
GGGCGGTTAGCTCAGTGGTAGAGCGCCTCGTTTACACCGAGGATGTCGGGAGTTCGACCC |
Downstream region at tRNA end position |
tcttttgata |
Secondary structure (Cloverleaf model) | >WENV170652254 Val TAC g ACCA tcttttgata G - C G - C G - C C - G G - C G - C T - A C C T C T C T C A G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T A G ATGTC C - G C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |