Sequence ID | >WENV170652543 |
Genome ID | JRYH01005587 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1395 |
End posion on genome | 1469 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gtttccggat |
tRNA gene sequence |
GCCCATGTAGCTCAGTGGTAGAGCACTCCCTTGGTAAGGGAGAGGCCACGTGTTCAATCC |
Downstream region at tRNA end position |
cgtccttctc |
Secondary structure (Cloverleaf model) | >WENV170652543 Thr GGT t ACCA cgtccttctc G - C C - G C - G C - G A - T T - A G - C C T T T G C A C A G A A | | | | | A T C T C G A C G T G C G | | | | T T G G A G C T A A AGGCC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |