Sequence ID | >WENV170652578 |
Genome ID | JRYH01007115 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1225 |
End posion on genome | 1301 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ccgcgggact |
tRNA gene sequence |
CTGCCCGTAGCTCAACCGGATAGAGCACCGGCCTTCTAAGCCGGGGGTTGCAGGTTCGAT |
Downstream region at tRNA end position |
ggaaaaaagg |
Secondary structure (Cloverleaf model) | >WENV170652578 Arg TCT t GCCA ggaaaaaagg C - G T - A G - C C - G C - G C - G G - C T T T C G T C C A C A A A | | | | | G C C T C G G C A G G C G | | | | T T G G A G C A T A A GGGTT C - G C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |