Sequence ID | >WENV170652596 |
Genome ID | JRYH01007799 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 355 |
End posion on genome | 429 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tccgggttgc |
tRNA gene sequence |
GCCCATGTGGCTCAGTGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCGCGCGTTCGATCC |
Downstream region at tRNA end position |
gttgattgaa |
Secondary structure (Cloverleaf model) | >WENV170652596 Thr GGT c ACCA gttgattgaa G - C C - G C - G C - G A - T T - A G - C C T T C G C G C A G A G | | | | | G T C T C G G C G C G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |